• Users Online: 148
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2018  |  Volume : 1  |  Issue : 6  |  Page : 208-213

O-6-methylguanine-DNA methyltransferase promoter methylation can change in glioblastoma recurrence due to intratumor heterogeneity


1 Department of Diagnostics and Public Health, University of Verona, Verona, Italy
2 Department of Biomedical Sciences and Morphological and Functional Images, University of Messina, Messina, Italy
3 Ircss Policlinico San Martino, Genova, Italy
4 Department of Human Pathology in Adulthood and Evolutive Age, University of Messina, Messina, Italy

Date of Web Publication27-Dec-2018

Correspondence Address:
Prof. Valeria Barresi
Department of Diagnostics and Public Health, Polyclinic G.B. Rossi, P.le L.A. Scuro, 1, 37134 Verona
Italy
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/glioma.glioma_38_18

Rights and Permissions
  Abstract 

Background and Aim: The standard-of-care for patients with glioblastoma (GBM) is surgery followed by concurrent chemotherapy with temozolomide and radiotherapy. O-6-methylguanine-DNA methyltransferase (MGMT) promoter methylation is commonly assessed in GBM as a predictive marker of response to temozolomide. Although MGMT methylation status has been shown to change between primary and recurrent GBM, no indication exists on retesting MGMT in recurrent GBM. In addition, what causes the change in MGMT methylation has yet to be identified. In this study, we aimed to investigate whether MGMT promoter methylation in recurrent GBM was influenced by intratumor heterogeneity in the initial GBM tumor. Materials and Methods: We investigated the status of MGMT promoter methylation in different samples taken from concentric layers of 24 GBMs and in 11-paired surgically resected recurrences. The neoplastic nature of samples submitted for methylation analysis was preliminary verified through histological examination; the fragments were accurately chosen to have adequate cellularity and minimal amount of nontumor contaminants. Results: About 27% (3 out of 11) of the recurrences had changed MGMT methylation status compared to the initial tumor. Initial tumor heterogeneity might play a role in this change, as all three cases had intratumor heterogeneity (with the central part of the tumor methylated and the peripheral part unmethylated) in the primary GBM. Conclusion: This study suggests that MGMT methylation variation in recurrent GBM may depend on intratumor heterogeneity in the initial tumor. Intratumor heterogeneity and possible changes in the recurrence should be taken into account when testing MGMT promoter methylation status as a predictive factor orienting therapeutic decisions in patients with GBM.

Keywords: Glioblastoma, heterogeneity, IDH, O-6-methylguanine-DNA methyltransferase, recurrence


How to cite this article:
Barresi V, Caffo M, De Luca G, Giuffrè G. O-6-methylguanine-DNA methyltransferase promoter methylation can change in glioblastoma recurrence due to intratumor heterogeneity. Glioma 2018;1:208-13

How to cite this URL:
Barresi V, Caffo M, De Luca G, Giuffrè G. O-6-methylguanine-DNA methyltransferase promoter methylation can change in glioblastoma recurrence due to intratumor heterogeneity. Glioma [serial online] 2018 [cited 2022 Nov 27];1:208-13. Available from: http://www.jglioma.com/text.asp?2018/1/6/208/248707


  Introduction Top


Glioblastoma (GBM) is one of the most frequent primary tumors of the central nervous system (CNS).[1] According to the World Health Organization classification of CNS tumors, it can be subdivided into IDH mutant and IDH wild-type, on the basis of the mutational status of IDH1/IDH2 genes.[1] GBM IDH wild-type is the most common subtype; it mainly affects elder patients and it carries worse prognosis, as compared to GBM IDH mutant.[1]

Regardless of IDH mutational status, the current standard of treatment of GBM includes surgery, followed by chemotherapy with temozolomide and radiotherapy.[2] However, despite treatment, the most GBM patients undergo recurrence and die within 12–24 months, while only about 10% of them survive ≥5 years.[2],[3]

A subset of GBMs have a silenced O-6-methylguanine-DNA methyltransferase (MGMT) gene, due to promoter methylation.[4] Since MGMT encodes for an enzyme which repairs DNA damage from alkylating agents, its expression is correlated to resistance to alkylating drugs, such as temozolomide.[4] On the other hand, MGMT promoter methylation is associated with higher sensitivity to temozolomide.[4] Thus, MGMT promoter methylation status is commonly assessed to predict responsiveness to temozolomide in GBM patients.

At present, no indication exists for the retesting (after initial tumor MGMT testing) of recurrent tumors after treatment. Indeed, contrasting results were reported on MGMT promoter methylation changing in GBM recurrence after chemoradiotherapy, with variable rates of change and conversion from methylated to unmethylated status and vice versa.[5],[6],[7],[8],[9],[10],[11],[12]

The reasons for MGMT methylation change have been hypothesized to be the result of clonal selection during therapy, technical problems, and inadequacy of sampling, or tumor heterogeneity.

MGMT intratumor heterogeneity has been evaluated in several studies.[13],[14],[15],[16],[17] However, the main drawback of these studies was that the tissue was not preselected before the methylation analysis, and thus did not exclude areas of necrosis or inflammation.

In this study, we evaluated whether the change in MGMT promoter methylation during recurrence in GBM was due to initial tumor intratumor heterogeneity. We took samples from different concentric areas, including the periphery and central aspect of the tumor in 24 formalin-fixed and paraffin-embedded GBMs, and 11-paired posttreatment recurrences. Tumor samples used for methylation analysis were preselected for adequate cellularity and without evidence of necrosis or inflammation.


  Materials and Methods Top


All procedures were performed in compliance with ethical standards and with Helsinki declaration principles. Patient's consent was obtained before the beginning of the study. Ethical issues were discussed with local ethics committee and it was decided that no formal approval was necessary. The study included 24 patients with surgically resected GBM (13 females and 11 male patients; age range: 42–73 years; mean age at diagnosis: 60.5 years). In all cases, the gross total resection was achieved. In the operation room, each tumor was subdivided into two different portions: peripheral (tumor portion adjacent to normal brain) and central, which were placed in different jars and fixed in formalin for 24 h at room temperature. Then, all samples were paraffin embedded and submitted for histological examination with hematoxylin and eosin (H and E) stain and immunohistochemical procedures.

Immunohistochemistry was performed using an automated immunostainer (Dako Autostainer Link 48 Instruments; Glostrup, Denmark) and the following antibodies against Olig-2 (clone 211F1.1, Cell Marque, Rocklin, CA, USA; 1:100), Glial Fibrillary Acidic Protein (clone 6F2; Dako, Glostrup, Denmark; 1:500), ATRX (Polyclonal; Life Science Sigma, St Louis, MO, USA; 1:750), IDH1 R132H (clone H09, Dianova, Gmbh, Germany; 1:200), p53 (clone DO-7, Glostrup, Denmark; 1:100), and Ki-67 (clone MIB-1, Glostrup, Denmark; 1:100).

In cases with negative IDH1 R132H stain, the mutational status of IDH1/ 2 genes was further evaluated by DNA sequencing. IDH1, IDH2 genes were amplified by polymerase chain reaction (PCR) and both strands were sequenced using the ABI PRISM 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). PCR conditions for IDH1 and IDH2 were the following: (1) initial denaturation step at 95°C for 5 min, (2) 40 cycles at 95°C/30 s, 58°C/30 s, and 72°C/30 s, and (3) a final step at 72°C/5 min. We used the following primers: IDH1-F CCATCACTGCAGTTGTAGGTT; IDH1-R GCAAAATCACATTATTGCCAAC; IDH2-F TGCAGTGGGACCACTATTATC; IDH2-R GTGCCCAGGTCAGTGGAT.

Thus, GBMs were subdivided into IDH mutant or IDH wild type. After surgery, all patients were submitted to concurrent radiotherapy and chemotherapy with temozolomide, according to the Stupp protocol.[2]

Follow-up data, including overall survival (OS) and recurrence-free survival, were available for all cases. Nineteen GBMs recurred during the follow-up time. In 11 cases, recurrent tumors were surgically resected. Surgical specimens were again split into two parts, peripheral and central, which were submitted to the same procedures described above.

O-6-methylguanine-DNA methyltransferase promoter methylation analysis

In each tumor specimen (peripheral or central), the areas with the highest number of tumor cells, and minimal amount of necrosis and inflammation were identified in a control H and E slide and marked by a pathologist. Those areas were manually dissected under microscopic guidance from the corresponding 20 μm section using a sterile blade and collected in a microtube. Finally, all samples (central and peripheral of each case) had at least 100 neoplastic cells, and a proportion between neoplastic cells and nonneoplastic contaminants >80%.

MGMT promoter methylation status was assessed by methylation-specific PCR (MS-PCR) using AlphaReal MGMT kit, which combines DNA extraction, DNA bisulfonation, and real-time PCR, according to the manufacturer instructions (Alphagenic Biotech Srl; Trieste, Italy).

Statistical analyses

The Fisher's exact test was used to analyze the statistical correlations between the intratumor heterogeneity or changing of MGMT promoter methylation status and the gender of the patients or IDH mutational status of the tumor.

The Mantel–Cox log-rank test was applied to assess the strength of association between OS and each of the parameters (age and gender of the patient, MGMT methylation status, IDH mutational status, and intratumor heterogeneity) as a single variable FS.

Statistical analysis was performed using MedCalc 12.1.4.0 statistical software (MedCalc Software, Mariakerke, Belgium). P < 0.05 was considered statistically significant.


  Results Top


Clinicopathological variables of GBMs in our cohort are shown in [Table 1]. Following immunohistochemistry and molecular analyses, GBMs were subdivided into 19 IDH wild-type (9 female and 10 male patients; age range: 50–73 years; mean age: 58.8 years) and 5 IDH mutant (4 female and 1 male patients; age range: 42–51 years; mean age: 46.4 years). All IDH mutant GBMs had R132H mutation; among them, two GBMs had originated from the progression of diffuse astrocytoma (DA), grade II. Thus, MGMT promoter methylation analysis was carried out in the preceding DA as well.
Table 1: Clinicopathological characteristics and O-6-methylguanine-DNA methyltransferase promoter methylation status in 24 glioblastomas and in 11 paired recurrences

Click here to view


MGMT promoter methylation status was homogenous throughout the tumor (i.e., peripheral and central part of the tumor had the same methylation status) in 19 (80%) GBMs and heterogeneous (i. e., peripheral and central part of the tumor had different methylation status) in 5 (20%) [Figure 1].
Figure 1: O-6-methylguanine-DNA methyltransferase promoter methylation status in 24 surgically resected GBMs

Click here to view


Among homogeneous GBMs, 12 (63%) were unmethylated and 7 (37%) were methylated [Figure 2]. All 12 unmethylated GBMs were IDH wild-type. Among 7 methylated tumors, 4 were IDH wild-type and 3 IDH mutant.
Figure 2: Glioblastomas with homogeneous O-6-methylguanine-DNA methyltransferase promoter methylation status

Click here to view


In all five of the GBMs with heterogeneous MGMT promoter methylation status, the central part of the tumor was methylated and the peripheral part was unmethylated [Figure 3]. Two of five cases were IDH mutant GBMs, which had originated from the progression of DAs with an unmethylated MGMT promoter [Figure 3]. Three of the five cases were IDH wild-type.
Figure 3: Glioblastomas with heterogeneous O-6-methylguanine-DNA methyltransferase promoter methylation status

Click here to view


Follow-up time ranged between 5 and 48 months. During this time, 18 cases recurred and 11 were submitted for surgical excision of the recurrent tumor. Time to progression ranged between 1 and 34 months. When we analyzed MGMT promoter methylation status in the recurrences, 8 (73%) cases were concordant with the primary tumor, while 3 (27%) were discordant [Figure 4]. In all three discordant cases, the primary tumor had heterogeneous MGMT promoter methylation status (peripheral part unmethylated and central part methylated) [Figure 5]. In one case, the initial tumor was an IDH mutant GBM, and its paired recurrent tumor was MGMT unmethylated [Figure 4], whereas, the other two cases were IDH wild-type GBMs, with recurrent MGMT methylated tumors [Figure 4].
Figure 4: O-6-methylguanine-DNA methyltransferase promoter methylation status in 11 surgically resected glioblastoma recurrences

Click here to view
Figure 5: Polymerase chain reaction amplification plots relative to a heterogeneous glioblastoma, with methylation changes occurring at the recurrence. The red curves refer to amplification of promoter methylated O-6-methylguanine-DNA methyltransferase, while the green ones refer to the amplification of promoter unmethylated O-6-methylguanine-DNA methyltransferase. In the primary tumor, the central part was methylated and peripheral one was unmethylated

Click here to view


Intratumor heterogeneity was significantly more frequent in GBMs taken from female patients (P = 0.0411). The switching of MGMT promoter methylation status was not associated with any clinicopathological variables.

In univariate analysis, IDH mutation (P = 0.0298), MGMT promoter methylation (P = 0.0115), and female gender (P = 0.0154) were significantly associated with longer OS. Due to the small number of cases, we could not perform multivariate analyses. Among recurring cases, surgical resection of recurrent tumor was significantly associated with longer OS (P = 0.0017).


  Discussion Top


Dynamic methylation changes of the MGMT promoter has been documented in several recurrent GBM studies but with different prevalences.[5],[6],[7],[8],[9],[10],[11],[12] In this study, 27% of recurrent GBMs had different MGMT promoter methylation status compared to the corresponding primary tumor. Interestingly, discordance was observed only in cases having a primary GBM with heterogeneous MGMT methylation status. Therefore, it is tempting to speculate that the changes in MGMT promoter methylation status in recurrent GBMs may descend from heterogeneity of tumor cells in the initial tumor, with subsequent subclonal expansion in the recurrence.

Several studies previously analyzed intratumor heterogeneity of MGMT promoter methylation status in GBM and with conflicting results.[13],[14],[15],[16],[17] Parkinson et al.[13] reported that MGMT promoter methylation status is homogeneous across different samples of GBM. However, all samples they analyzed had been taken from the peripheral part of the tumors, and none from their central part.[13] In two other studies, MGMT promoter methylation heterogeneity was found in a small proportion of GBMs.[14],[16] However, the authors claimed that heterogeneity could depend on the presence of high number of nontumor contaminants in the unmethylated parts of the tumors.[14],[16]

Interestingly, Della Puppa et al.[17] found intratumor heterogeneity of MGMT promoter methylation in 33.3% of GBMs. In their study, MGMT methylation analysis was carried out in different concentric samples of GBMs.[17] Indeed, they hypothesized that tumor stem cells, which are the most resistant to temozolomide, mainly reside in the central part of the tumor.[18] In their heterogeneous samples, MGMT promoter methylation status was different in the intermediate part of the tumor compared to the peripheral and inner parts.[18] However, methylation analysis had been carried out on frozen samples, with no histological verification, and eventual exclusion of nonneoplastic contaminants.[18]

In this study, we found MGMT promoter methylation at the center, but not at the periphery of the tumor, in 20% of GBMs. Heterogeneity could not be related to sample inadequacy. Indeed, methylation analysis was performed on histologically verified neoplastic samples, with selected areas having adequate number of neoplastic cells and low amount of nontumor contaminants. Interestingly, two of the heterogeneous cases were IDH mutant GBMs, which had originated from the progression of LGAs. Since the corresponding LGAs were unmethylated, we can suppose that MGMT methylation was acquired in a subclone of tumor cells during progression, thus leading to heterogeneous methylation status in the secondary GBM. This is intriguing given that IDH mutations have been shown to induce extensive DNA methylation in gliomas.[19] Accordingly, all the homogeneously unmethylated GBMs in our cohort were IDH wild type tumors.

To the best of our knowledge, only one study in LGAs investigated MGMT methylation status in relation to IDH mutational status.[20] In that study, the majority of IDH mutant LGAs had MGMT promoter methylation,[20] in accordance with the hypermethylated status of IDH mutant tumors.[19] However, a small proportion of IDH mutant astrocytomas had unmethylated MGMT and this condition was associated with worse prognosis,[20] similarly to that observed in our cases, which progressed to GBM.

In our cohort of patients, MGMT methylation and IDH mutation were significantly associated with longer OS, which confirm their relevant prognostic value in GBM patients.[1],[21] In addition, female gender was a favorable prognostic factor in our cohort, similarly to that reported in the study by Franceschi et al.[22] Interestingly, among recurring tumors, surgery of recurrences increased the OS, which is in line with the findings in other studies.[23],[24]


  Conclusion Top


This study confirms that MGMT methylation status can vary in recurrent GBM, and that it can change from methylated to unmethylated and vice versa in comparison to the original tumor. The fact that MGMT promoter methylation can change from initial tumor to recurrent tumor, raises the question of whether retesting of recurrent tumors is needed for therapeutic decisions. For instance, if the initial tumor is unmethylated but at recurrence becomes methylated, would a rechallenge with temozolomide be indicated? According to our results, MGMT variation may depend on intratumor heterogeneity in the primary GBM, which can be observed in both IDH mutant and IDH wild type tumors. Since MGMT promoter methylation status seems to vary according to a spatial criterion, further studies on larger cohorts are needed to clarify the site from which, the optimal tumor specimen for methylation analysis should be taken.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Luois DN, Ohgaki H, Wisteler OD, Cavenee WK, Ellison DW, Figarella-Branger D, et al. WHO Classification of Tumors of the Central Nervous System. Lyon: IARC Press; 2016.  Back to cited text no. 1
    
2.
Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987-96.  Back to cited text no. 2
    
3.
Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 2009;10:459-66.  Back to cited text no. 3
    
4.
Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, Vanaclocha V, et al. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med 2000;343:1350-4.  Back to cited text no. 4
    
5.
Brandes AA, Franceschi E, Tosoni A, Bartolini S, Bacci A, Agati R, et al. O (6)-methylguanine DNA-methyltransferase methylation status can change between first surgery for newly diagnosed glioblastoma and second surgery for recurrence: Clinical implications. Neuro Oncol 2010;12:283-8.  Back to cited text no. 5
    
6.
Felsberg J, Thon N, Eigenbrod S, Hentschel B, Sabel MC, Westphal M, et al. Promoter methylation and expression of MGMT and the DNA mismatch repair genes MLH1, MSH2, MSH6 and PMS2 in paired primary and recurrent glioblastomas. Int J Cancer 2011;129:659-70.  Back to cited text no. 6
    
7.
Metellus P, Coulibaly B, Nanni I, Fina F, Eudes N, Giorgi R, et al. Prognostic impact of O6-methylguanine-DNA methyltransferase silencing in patients with recurrent glioblastoma multiforme who undergo surgery and carmustine wafer implantation: A prospective patient cohort. Cancer 2009;115:4783-94.  Back to cited text no. 7
    
8.
Jung TY, Jung S, Moon KS, Kim IY, Kang SS, Kim YH, et al. Changes of the O6-methylguanine-DNA methyltransferase promoter methylation and MGMT protein expression after adjuvant treatment in glioblastoma. Oncol Rep 2010;23:1269-76.  Back to cited text no. 8
    
9.
Park CK, Kim JE, Kim JY, Song SW, Kim JW, Choi SH, et al. The changes in MGMT promoter methylation status in initial and recurrent glioblastomas. Transl Oncol 2012;5:393-7.  Back to cited text no. 9
    
10.
Brandes AA, Franceschi E, Paccapelo A, Tallini G, De Biase D, Ghimenton C, et al. Role of MGMT methylation status at time of diagnosis and recurrence for patients with glioblastoma: Clinical implications. Oncologist 2017;22:432-7.  Back to cited text no. 10
    
11.
O'Regan CJ, Kearney H, Beausang A, Farrell MA, Brett FM, Cryan JB, et al. Temporal stability of MGMT promoter methylation in glioblastoma patients undergoing STUPP protocol. J Neurooncol 2018;137:233-40.  Back to cited text no. 11
    
12.
Christmann M, Nagel G, Horn S, Krahn U, Wiewrodt D, Sommer C, et al. MGMT activity, promoter methylation and immunohistochemistry of pretreatment and recurrent malignant gliomas: A comparative study on astrocytoma and glioblastoma. Int J Cancer 2010;127:2106-18.  Back to cited text no. 12
    
13.
Parkinson JF, Wheeler HR, Clarkson A, McKenzie CA, Biggs MT, Little NS, et al. Variation of O(6)-methylguanine-DNA methyltransferase (MGMT) promoter methylation in serial samples in glioblastoma. J Neurooncol 2008;87:71-8.  Back to cited text no. 13
    
14.
Grasbon-Frodl EM, Kreth FW, Ruiter M, Schnell O, Bise K, Felsberg J, et al. Intratumoral homogeneity of MGMT promoter hypermethylation as demonstrated in serial stereotactic specimens from anaplastic astrocytomas and glioblastomas. Int J Cancer 2007;121:2458-64.  Back to cited text no. 14
    
15.
Parker NR, Hudson AL, Khong P, Parkinson JF, Dwight T, Ikin RJ, et al. Intratumoral heterogeneity identified at the epigenetic, genetic and transcriptional level in glioblastoma. Sci Rep 2016;6:22477.  Back to cited text no. 15
    
16.
Hamilton MG, Roldán G, Magliocco A, McIntyre JB, Parney I, Easaw JC, et al. Determination of the methylation status of MGMT in different regions within glioblastoma multiforme. J Neurooncol 2011;102:255-60.  Back to cited text no. 16
    
17.
Della Puppa A, Persano L, Masi G, Rampazzo E, Sinigaglia A, Pistollato F, et al. MGMT expression and promoter methylation status may depend on the site of surgical sample collection within glioblastoma: A possible pitfall in stratification of patients? J Neurooncol 2012;106:33-41.  Back to cited text no. 17
    
18.
Pistollato F, Abbadi S, Rampazzo E, Persano L, Della Puppa A, Frasson C, et al. Intratumoral hypoxic gradient drives stem cells distribution and MGMT expression in glioblastoma. Stem Cells 2010;28:851-62.  Back to cited text no. 18
    
19.
Bell EH, Zhang P, Fisher BJ, Macdonald DR, McElroy JP, Lesser GJ, et al. Association of MGMT promoter methylation status with survival outcomes in patients with high-risk glioma treated with radiotherapy and temozolomide: An analysis from the NRG oncology/RTOG 0424 trial. JAMA Oncol 2018;4:1405-9.  Back to cited text no. 19
    
20.
Turcan S, Rohle D, Goenka A, Walsh LA, Fang F, Yilmaz E, et al. IDH1 mutation is sufficient to establish the glioma hypermethylator phenotype. Nature 2012;483:479-83.  Back to cited text no. 20
    
21.
Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, Weller M, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 2005;352:997-1003.  Back to cited text no. 21
    
22.
Franceschi E, Tosoni A, Minichillo S, Depenni R, Paccapelo A, Bartolini S, et al. The prognostic roles of gender and O6-methylguanine-DNA methyltransferase methylation status in glioblastoma patients: The female power. World Neurosurg 2018;112:e342-7.  Back to cited text no. 22
    
23.
Perrini P, Gambacciani C, Weiss A, Pasqualetti F, Delishaj D, Paiar F, et al. Survival outcomes following repeat surgery for recurrent glioblastoma: A single-center retrospective analysis. J Neurooncol 2017;131:585-91.  Back to cited text no. 23
    
24.
Pala A, Schmitz AL, Knoll A, Schneider M, Hlavac M, König R, et al. Is MGMT promoter methylation to be considered in the decision making for recurrent surgery in glioblastoma patients? Clin Neurol Neurosurg 2018;167:6-10.  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1]


This article has been cited by
1 Changes of O6-Methylguanine DNA Methyltransferase (MGMT) Promoter Methylation in Glioblastoma Relapse—A Meta-Analysis Type Literature Review
Jonas Feldheim,Almuth F. Kessler,Camelia M. Monoranu,Ralf-Ingo Ernestus,Mario Löhr,Carsten Hagemann
Cancers. 2019; 11(12): 1837
[Pubmed] | [DOI]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed3221    
    Printed251    
    Emailed1    
    PDF Downloaded309    
    Comments [Add]    
    Cited by others 1    

Recommend this journal